Now showing items 1-20 of 115

A proposal of a conceptual framework for the development of entomology research projects and related sciences.

Farji Brener, Alejandro G. (Universidad del ValleColombia, 2019-08-30)

Planning research projects is a challenge that many students fail to successfully overcome. A lack of formal training in research planning and design, an excessive emphasis on analysis rather than on ideas and a lack of a ...
Abundancia y preferencia trófica de dichotomius belus (coleoptera : scarabaeidae) en la Reserva Forestal de Colosó, Sucre.

Bohórquez Mieles, Juan Carlos; Montoya Lerma, James (2011-10-06)

En este estudio se evaluaron la fluctuación poblacional y la preferencia trófica del escarabajo Dichotomius belus. Entre marzo y octubre del 2002, se realizó un muestreo a través de transectos longitudinales en tres hábitats ...
Acaricidal activity and repellency of Blechnum cordatum (Blechnaceae) against Tetranychus urticae (Acari: Tetranychidae).

Hincapié, Carlos A.; Alarcón, Julio; Monsalve, Zulma I.; Céspedes, Carlos L. (Universidad del ValleColombia, 2019-12-31)

Tetranychus urticae is a highly polyphagous mite species, with 1,140 host plant species reported worldwide. In this study, both Blechnum cordatum toxicity and repellent activity against T. urticae are reported. Regarding ...
Actividad disuasiva y biocida de Salvia officinalis con inducción de malformaciones en Aedes aegypti (Diptera : Culicidae).

Castillo Morales, Ruth M.; Duque Luna, Jonny Edward (Universidad del ValleColombia, 2020-12-26)

Diferentes estudios han evaluado la actividad biocida de aceites esenciales (AEs) en larvas de mosquitos de importancia médica. Sin embargo, son limitadas las investigaciones que analizan los efectos de los AEs en todos ...
Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides.

Torres Torres, Lissette; Espinel Correal, Carlos; Santos Díaz, Adriana Marcela (Universidad del ValleColombia, 2020-12-26)

The entomopathogenic fungi Metarhizium anisopliae (Ascomycota: Clavicipitaceae) and Beauveria bassiana (Ascomycota: Cordycipitaceae) are an alternative for the control of grassland pests (e.g. Rhammatocerus schistocercoides ...
Ants (Hymenoptera: Formicidae) of Durango, México.

Soto Cárdenas, Miguel Angel; Vásquez Bolaños, Miguel; Gutiérrez García, Cipriano; Correa Ramírez, Miguel Mauricio; Torres Ricario, René; González Güereca, Martha Celina; Chairez Hernández, Isaias (Universidad del ValleColombia, 2019-12-31)

Ants are eusocial insects of wide functional and taxonomic diversity, with worldwide distribution in various terrestrial ecosystems (some introduced by man), with the exception of the poles and in the high mountain peaks. ...
Arthropod pests and their management, natural enemies and flora visitors associated with castor (Ricinus communis), a biofuel plant: a review.

López Guillén, Guillermo; Gómez Ruiz, Jaime; Barrera, Juan F. (Universidad del ValleColombia, 2020-07-09)

Interest in bioenergetic crops, such as the castor oil plant Ricinus communis (Euphorbiaceae), for production of biodiesel has increased in recent years. In this paper, phytophagous arthropods, their natural enemies and ...
Arthropods associated with Callisthene fasciculata (Vochysiaceae) canopy in the Pantanal of Mato Grosso, Brazil.

Yamazaki, Lúcia; Vindica, Vanessa França; Isaac Marques, Marinêz; Battirola, Leandro Dênis (Universidad del ValleColombia, 2020-07-09)

Studies on arthropods associated with tropical rainforest canopies contribute to a further understanding of forest canopy community dynamics and their relationship to the structure and function of this ecosystem. This study ...
Associated entomofauna with edible canna crops Canna indica (Cannaceae) in three areas of Colombia.

Ortega, María Camila; Mojica Ramos, Sindy Lorena; Vergara Navarro, Erika Valentina; Sotelo Cardona, Paola (Universidad del ValleColombia, 2020-07-09)

Edible canna (Canna indica) is a native crop from the Andes Cordillera and cultivated in Colombia to obtain starch from its rhizomes. Starch is used mostly as a raw material in biscuits and other local products for local ...
Boquillas de pulverización hidráulicas para la aplicación de nematodos entomopatógenos.

Batista de Alvarenga, Cleyton; Andaló, Vanessa; Oliveira Machado, Felipe Augusto; Zampiroli, Renan; Mieko, Jéssica; Silva de Faria, Lucas (Universidad del ValleColombia, 2018-12-31)

Biological control is a viable alternative to chemical control; however, some methods of releasing control agents still need to be improved in order to attract the attention of producers and to reduce costs. Therefore, ...
Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge.

Fernandes de Souza, Gezilene; Demolin Leite, Germano Leão; Souza Silva, Farley William; Arruda Sampaio, Regynaldo; Silva, Júlia Letícia; Texeira, Gustavo Leal; Alvarenga Soares, Marcus; Cola Zanuncio, José (Universidad del ValleColombia, 2021-02-03)

Sewage sludge is a nitrogen-rich organic compound, which can be used to aid development in plants such as Platycyamus regnellii (Fabaceae), in the recovery of degraded areas. This study aimed to assess the bottom-up effects ...
Caracterización de tres endosimbiontes de la mosca blanca: Bemisia tabaci (Hemiptera: Aleyrodidae) de Colombia

Bedoya Saldarriaga, Mailyn Alejandra (Universidad del ValleColombiaFACULTADES DE CIENCIAS NATURALES Y EXACTASBIOLOGÍA, 2016)

Muchas especies de insectos albergan bacterias simbiontes intracelulares y su interacción puede ser parásita, neutral o mutualista. A este último tipo parece pertenecer la asociación de la mosca blanca, B. tabaci y sus ...
Caracterización molecular de la resistencia en yuca (manihot esculenta crantz) al ataque del ácaro verde (mononychellus tanajoa) : una aproximación proteómica

Marín Colorado, Jaime Alberto (Universidad del ValleColombiaFACULTADES DE CIENCIAS NATURALES Y EXACTASDOCTORADO EN CIENCIAS - BIOLOGÍA, 2015)

El ácaro verde, Mononychellus tanajoa (Acari: Tetranychidae), es una de las principales plagas de la yuca, causando daños directamente al chupar la savia. Aunque tiene una amplia distribución en América Latina, África y ...
Checklist with a key to genera and subgenera of dung beetles (Coleoptera: Scarabaeidae: Scarabaeinae) present and supposed for Ecuador.

Chamorro, William; Marín Armijos, Diego; Granda, Valeria; Vaz de Mello, Fernando Z. (Universidad del ValleColombia, 2018-07-08)

The beetles of the Subfamily Scarabaeinae are a group that have been used in taxonomic, ecological, natural history, biodiversity and conservation studies recently, as they are good indicators of habitat quality and due ...
Chromosome numbers in insects of Argentina I. Cytogenetic characterization of 15 species with economic importance.

Páez, Valeria de los Angeles; Andrada, Aldo R.; Moreno Ruiz, María M.; Silenzi Usandivaras, Gabriela M.; Oviedo, Andrea; Ruiz de Bigliardo, Graciela E. (Universidad del ValleColombia, 2020-07-09)

In the present study, the somatic and gametic chromosome numbers in fifteen species of insects from Argentina are reported. Said species are characterized for their economic importance as pest of crops or as agricultural ...
Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.

Ramos Hernández, Eder; Lesher Gordillo, María Juliana; Ortiz García, Carlos Fredy; Oropeza Salín, Carlos; Sánchez Soto, Saúl; Magaña Alejandro, Miguel Ángel; Narváez C., María del S. (Universidad del ValleColombia, 2020-12-26)

The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many ...
Comparison of the volatiles composition between healthy and buprestid infected Juglans regia (Juglandaceae).

Cui, Yaqin; Kong, Shuqing; Liu, Xinhai; Liu, Suicun (Universidad del ValleColombia, 2020-07-09)

Meliboeus ohbayashii primoriensis (Coleoptera: Buprestidae) is an important pest of the walnut tree Juglans regia (Juglandaceae), but the volatiles mediating this plant–herbivore interaction are unknown. In this study, ...
Composting to control the leaf-cutting ant Atta cephalotes L. (Hymenoptera: Formicidae)

Armbrecht, Inge; Gallego Ropero, María Cristina; Montoya Correa, Mavir; Montoya Lerma, James (2013-06-28)

Las hormigas cortadoras de hojas, Atta y Acromyrmex, son los herbívoros más importantes en los trópicos. En este estudio se comparan los efectos de dos métodos no químicos sobre la sobrevivencia y actividad de nidos de ...
¿Cómo responde la hormiga cortadora de hojas Atta Cephalotes (Hymenoptera : Myrmicinae) a la remoción mecánica de sus nidos?

Montoya Correa, Mavir; Montoya Lerma, James; Armbrecht, Inge; Gallego Ropero, María Cristina (2011-10-06)

En Colombia, eventualmente, se utiliza la excavación y extracción de la reina de los nidos para eliminar sociedades incipientes de la hormiga cortadora de hojas Atta cephalotes. Sin embargo, no es claro si éste controla ...
Depredadores de escarabajos de la corteza (Coleoptera) en la región de Balikesir de Turquía.

Huseyin Cebeci, Haci; Baydemir, Mustafa (Universidad del ValleColombia, 2018-12-31)

El objetivo de este estudio fue determinar la diversidad de los depredadores de los escarabajos de la corteza en los bosques de coníferas de la provincia de Balıkesir en Turquía. Se establecieron seis parcelas que contenían ...

Envíos recientes

A proposal of a conceptual framework for the development of entomology research projects and related sciences.

Farji Brener, Alejandro G. | 2019-08-30

Planning research projects is a challenge that many students fail to successfully overcome. A lack of formal training in research planning and design, an excessive emphasis on analysis rather than on ideas and a lack of a guide are some of the possible causes of this problem. This essay proposes a conceptual framework that is of didactic utility to guide students in their research projects in entomology and related sciences. Three approximations and three approaches are presented. The proposed approximations are: descriptive, deductive observational and deductive experimental. The first is useful to design descriptive projects, where natural patterns are discovered and determined, and thus it is unnecessary and inaccurate to specify hypotheses and predictions. Deductive approximations use the hypothetical-deductive method and thus need to specify a priori the ideas being tested and the consequences if they are true. In the first deductive approximation, the predictions come from observational data, while in the second they come from experiments. Three approaches proposed are: comparative, associative and manipulative. The first two approaches can be used in both the descriptive and the deductive observational approximations. However, the manipulative approach is necessary if the experimental approximation is used. All these approximations and approaches have strengths and weaknesses; they are complementary rather than exclusive and are illustrated with an ecological study. It is expected that this conceptual framework may be a didactic and useful tool for teachers and students.

LEER
Abundancia y preferencia trófica de dichotomius belus (coleoptera : scarabaeidae) en la Reserva Forestal de Colosó, Sucre.

Bohórquez Mieles, Juan Carlos | 2011-10-06

En este estudio se evaluaron la fluctuación poblacional y la preferencia trófica del escarabajo Dichotomius belus. Entre marzo y octubre del 2002, se realizó un muestreo a través de transectos longitudinales en tres hábitats ecológicos (Bosque de galería, Bosque secundario y Potreros) en Colosó, una reserva de bosque seco de la costa norte de Colombia. Los especímenes fueron colectados a partir de muestras separadas de tres tipos de cebos (carne en descomposición y excrementos humano y vacuno) a lo largo de transectos distribuidos en las tres zonas. Un total de 298 individuos fueron colectados entre las épocas seca y lluviosa, pudiendo evidenciar la tendencia que tiene D. belus por los hábitats con presencia de cobertura vegetal. Se observó una correlación entre la abundancia y la precipitación (r = 0.55 > 0.01). En cuanto a la preferencia trófica se encontraron diferencias en la elección de cebos atrayentes por parte de estos individuos, siendo el recurso de mayor preferencia el excremento humano, seguido por carroña y vacuno.

LEER
Acaricidal activity and repellency of Blechnum cordatum (Blechnaceae) against Tetranychus urticae (Acari: Tetranychidae).

Hincapié, Carlos A. | 2019-12-31

Tetranychus urticae is a highly polyphagous mite species, with 1,140 host plant species reported worldwide. In this study, both Blechnum cordatum toxicity and repellent activity against T. urticae are reported. Regarding toxicity, the ethyl acetate fraction at 250 ppm and the n-hexane fractions at 250 ppm and 100 ppm caused the greatest accumulated mortality rate when application was made starting during the larval stage. Results showed that even at the lowest evaluated concentration (10 ppm), both fractions caused a significant decrease in the T. urticae population. The n-hexane fraction caused 100 % repellency at 50 ppm and repellency significantly superior to the control at 10 ppm. Relatively low activity was found when treatments were applied directly to adults. In addition, results suggest that the cumulative mortality could have been caused by starvation due to the observed repellency and the well-known deterrent activity of phytoecdysteroids (PEs) found in the extracts. Four PEs from the B. cordatum n-hexane fraction were isolated: ecdysone, ponasterone A, shidasterone and 2-deoxycrustecdysone.

LEER
Actividad disuasiva y biocida de Salvia officinalis con inducción de malformaciones en Aedes aegypti (Diptera : Culicidae).

Castillo Morales, Ruth M. | 2020-12-26

Diferentes estudios han evaluado la actividad biocida de aceites esenciales (AEs) en larvas de mosquitos de importancia médica. Sin embargo, son limitadas las investigaciones que analizan los efectos de los AEs en todos los estadíos del ciclo de vida de Aedes aegypti. Este estudio evalúa la actividad biológica del AE de Salvia officinalis frente a Ae. aegypti. Se evaluó la actividad ovicida a concentraciones de 1, 5, 37 y 50 mg.L-1 en huevos de 0-12 h y huevos de 0-72 h. La actividad larvicida, pupicida y adulticida fue evaluada a concentraciones exploratorias (CE) y múltiples. Para la actividad repelente se empleó una CE de 1.000 mg.L-1 en intervalos de 0-2 min y de 2-15 min de exposición en antebrazos de voluntarios. La actividad disuasiva de oviposición se estimó a CE de 5, 50 y 200 mg.L-1. El AE causó malformaciones en embriones y alteración de las larvas. La mayor actividad larvicida fue a 63 y 76 mg.L-1 (27 ± 13,4 y 37 ± 18,6 %) a 24 h. La mayor mortalidad pupicida fue a 310 y 390 mg.L-1 (89 ± 1,53 and 100 ± 0 %) a las 48 h. La mortalidad adulticida a 300 mg.L-1 fue de 57,5 ± 0 % y el porcentaje de repelencia fue de 42 ± 4,7 %. La acción disuasiva a 200 mg.L-1 fue de 97 ± 4,81 %, con un índice de actividad de ovipostura de -0,94. S. officinalis mostró un efecto biocida en embriones y mortalidad de pupas y adultos, lo que revela que tiene un uso potencial en programas de control focalizados en estos estadios de desarrollo.

LEER
Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides.

Torres Torres, Lissette | 2020-12-26

The entomopathogenic fungi Metarhizium anisopliae (Ascomycota: Clavicipitaceae) and Beauveria bassiana (Ascomycota: Cordycipitaceae) are an alternative for the control of grassland pests (e.g. Rhammatocerus schistocercoides (Orthoptera: Acrididae) and soybean pests (e.g. Cerotoma tingomariana; Coleoptera: Chrysomelidae). To use these microorganisms as active principles of micoinsecticides, it is necessary to have quality control methods (microbiological, physicochemical and biological activity) accuracy, and reproducibility in a given timeframe. For this reason and given the difficulty in obtaining individuals in the field and in the establishment of the rearing of R. schistocercoides and C. tingomariana, we established methods for the routine evaluation of biological activity using alternative hosts. For M. anisopliae directed to the control of R. schistocercoides, the model insects Diatraea saccharalis (Lepidoptera: Crambidae) and Spodoptera frugiperda (Lepidoptera: Noctuidae) were tested, and for B. bassiana directed to the control of the target insect C. tingomariana, the model insects D. saccharalis and Chloridea virescens (Lepidoptera: Noctuidae) were evaluated. D. saccharalis and C. virescens were selected as alternative insects to evaluate the efficacy of M. anisopliae and B. bassiana, respectively. Efficacy was close to 80 % for both pathogens. The methods with the selected alternative insects were standardized and showed that they are repeatable and reproducible under the evaluated conditions

LEER
Ants (Hymenoptera: Formicidae) of Durango, México.

Soto Cárdenas, Miguel Angel | 2019-12-31

Ants are eusocial insects of wide functional and taxonomic diversity, with worldwide distribution in various terrestrial ecosystems (some introduced by man), with the exception of the poles and in the high mountain peaks. About 15,947 species have been described. In Mexico, 973 are known within 94 genera, and for the state of Durango 60 species are registered within 25 genera. However, the Formicidae knowledge in Durango State is limited as it has received little attention; this is mainly due to the lack of specialists, as well as the territorial extension of it. In order to know the myrmecofauna of the state of Durango, collections were made every 15 days between August 1, 2016 and August 1, 2017, in 56 sites in 19 municipalities located in different ecoregions of the State. Forty (40) species belonging to 24 genera were collected; the Myrmicinae subfamily was the most diverse with 21 species, followed by Formicinae (12 spp.), Dolichoderinae (5 spp.) and Dorylinae and Ponerinae with one species each. Ten (10) more ant species are registered for the state of Durango, the richness increasing from 60 to 70 species and from 25 to 32 genera. This study represents the first effort to know the myrmecofauna of the state of Durango, Mexico.

LEER
Arthropod pests and their management, natural enemies and flora visitors associated with castor (Ricinus communis), a biofuel plant: a review.

López Guillén, Guillermo | 2020-07-09

Interest in bioenergetic crops, such as the castor oil plant Ricinus communis (Euphorbiaceae), for production of biodiesel has increased in recent years. In this paper, phytophagous arthropods, their natural enemies and floral visitors associated with this plant in the world are reviewed. Despite its insecticidal properties, arthropods have been reported feeding on R. communis plants. The arthropod pests of R. communis damage all parts of the plant, including the seeds, where some toxic compounds are even more concentrated. In the scientific databases, we found reports of 193 arthropods associated to R. communis in different parts of the world. This information obtained in the scientific databases was concentrated in a database and analyzed according to the coevolutive hypothesis, which allows us to predict that the greatest wealth and abundance of phytogenic arthropods is found in the center of origin by R. communis. According to this review, Achaea janata, Spodoptera litura, Edwardsiana flavescens, Liriomyza trifolii, L. sativae, Spilosoma obliqua, Cogenethes punctiferalis, Oxyrhachis taranda, and Helicoverpa armigera are the most devastating pests in Asia. In Africa, Agrotis ipsilon, S. exigua, Nezara viridula, Trialeurodes ricini, and Tetranychus urticae were mentioned as the most important. In Central and South-America, Phyllophaga sp., Agrietes sp., Erinnyis ello, N. viridula, Corythucha gossypii, Falconia antioquiana, and S. marima are reported as pests of economic importance. The most commonly reported natural enemies of some of these arthropod pests were species of Bacillus thuringiensis, B. cereus, B. popilliae, Trichogramma achaeae, T. chilonis, T. minutum, T. australicum, T. dendrolimi, T. pretiosum, T. evanescens, Microplitis rufiventris, M. maculipennis, M. ophiusae, Telenomus remus, T. proditor, Stethorus siphonulus and S. histrio. Apis mellifera is recorded as the main insect pollinator of R. communis. Pest management methods used against the arthropod pests of R. communis include biological, ethological, mechanical, cultural, genetic, and chemical control.

LEER
Arthropods associated with Callisthene fasciculata (Vochysiaceae) canopy in the Pantanal of Mato Grosso, Brazil.

Yamazaki, Lúcia | 2020-07-09

Studies on arthropods associated with tropical rainforest canopies contribute to a further understanding of forest canopy community dynamics and their relationship to the structure and function of this ecosystem. This study evaluated arthropod community composition in monodominant Callisthene fasciculata forest canopy throughout the high water and dry periods in the northern region of the Pantanal in Mato Grosso, Brazil, as a part of a project about arboreal canopy arthropods associated with monodominant areas in this region. Sampling was conducted on 12 individuals of C. fasciculata, six from the high-water season (2010) and six from the dry season (2011), using insecticide fogging. A total of 28,197 arthropods were collected. Hymenoptera (the majority being Formicidae), Diptera, Acari, Thysanoptera, Hemiptera and Coleoptera, were the most representative groups. Although the analysis did not show variation in the abundance of individuals between the high water and dry seasons, the arthropod community varied significantly in taxa composition. Opiliones, Embioptera, Ephemeroptera and Scorpiones occurred only during the high-water period, with Polyxenida and Strepsiptera occurring only in the dry season. Thysanoptera was more abundant in the dry season, showing a relationship with the beginning of the C. fasciculata flowering period. In general, the high water and dry seasons maintain distinct communities in this habitat, illustrating how the temporal variation in the phenology of C. fasciculata imposed by the Pantanal’s hydrological regime alters the composition of the associated arthropod communities in the canopy of these monodominant formations in the Pantanal of Mato Grosso.

LEER
Associated entomofauna with edible canna crops Canna indica (Cannaceae) in three areas of Colombia.

Ortega, María Camila | 2020-07-09

Edible canna (Canna indica) is a native crop from the Andes Cordillera and cultivated in Colombia to obtain starch from its rhizomes. Starch is used mostly as a raw material in biscuits and other local products for local and regional consumption manufacture. However, edible canna producers have shown recent concern about new pest effects that may be limiting crop productivity. This study aimed to identify the main insects associated with edible canna plants. Visits were made to production areas in departments of Cundinamarca, Huila, and Nariño. Several harmful Lepidoptera in their larval stage were identified, such as Glyphipterix sp. (Glyphipterigidae), Spodoptera sp. (Noctuidae), Calpodes ethlius and Cobalus cannae (Hesperiidae), and Ischnodemus sp. (Hemiptera: Blissidae). The emergence of adults of a parasitoid wasp of the family Ichneumonidae was observed from larvae of the microlepidopteran Glyphipterix sp. Two natural enemies of Ischnodemus sp., an egg-parasitoid wasp (Chalcidoidea), and the entomopathogenic fungus Beauveria bassiana were collected. Besides, other beneficial insects were collected. This information can serve as a basis for upcoming studies on the biology, and habits of the main insect pests of edible canna (Canna indica), as well as potential biological control agents to generate recommendations for control and management in edible canna crops.

LEER
Boquillas de pulverización hidráulicas para la aplicación de nematodos entomopatógenos.

Batista de Alvarenga, Cleyton | 2018-12-31

Biological control is a viable alternative to chemical control; however, some methods of releasing control agents still need to be improved in order to attract the attention of producers and to reduce costs. Therefore, this work was conducted to evaluate the effects of hydraulic spray nozzles on the viability and infectivity of entomopathogenic nematodes. The experiment was conducted using a completely randomized design with 37 treatments, of which there were three controls and 34 treatments using different spray nozzles with six repetitions. A spraying table was used for the applications. The working pressure was 400 kPa for all nozzles and the solution sprayed consisted of an aqueous suspension of the nematode Heterorhabditis amazonensis MC01 at a concentration of 400 infective juveniles (IJ) mL-1. The viability of the IJ after being sprayed, as well as the infectivity of Tenebrio molitor larvae were verified. The results indicated that nematode viability was influenced by the nozzles and the living nematodes sprayed did not lose their capacity to infect the insect.

LEER
Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge.

Fernandes de Souza, Gezilene | 2021-02-03

Sewage sludge is a nitrogen-rich organic compound, which can be used to aid development in plants such as Platycyamus regnellii (Fabaceae), in the recovery of degraded areas. This study aimed to assess the bottom-up effects on leaf mass and percentage of ground cover (leaf litter, herbaceous plants, and grasses) in P. regnellii trees fertilized (or not) with dehydrated sewage sludge and arthropod communities over 24 months. Platycyamus regnellii trees fertilized with dehydrated sewage sludge presented significantly more leaves per branch, branches per tree, and a higher percentage of ground cover compared to unfertilized trees. Phenacoccus sp. (Pseudococcidae) was the most abundant phytophagous insect associated with P. regnellii trees. Fertilization did not affect the abundance, diversity, and species richness of Hemiptera phytophagous on P. regnellii trees. However, fertilized trees presented higher abundance and species richness of trophobiont-tending ants compared to unfertilized trees, with Camponotus sp. being the most abundant regardless of the treatment. Fertilized P. regnellii trees also presented higher species richness of natural enemies compared to unfertilized ones, with Aranae and Dolichopodidae being the most abundant. We concluded that fertilization with dehydrated sewage sludge improved P. regnellii trees leaf mass and ground cover and increased the diversity of trophobiont-tending ants and natural enemies. To our knowledge, this is the first study on the arthropods community associated with this tree species. This suggests that upon fertilization, P. renellii trees are useful for ecological restoration in severely disturbed areas.

LEER
Caracterización de tres endosimbiontes de la mosca blanca: Bemisia tabaci (Hemiptera: Aleyrodidae) de Colombia

Montoya Lerma, James | 2016

Muchas especies de insectos albergan bacterias simbiontes intracelulares y su interacción puede ser parásita, neutral o mutualista. A este último tipo parece pertenecer la asociación de la mosca blanca, B. tabaci y sus endosimbiontes, quienes le proporcionan nutrientes esenciales y facultan con características como tolerancia a altas temperaturas. En este estudio se identificoó la presencia de los endosimbiontes de B. tabaci: Portiera, Hamiltonella y Rickettsia en poblaciones provenientes de diferentes regiones de Colombia. Se encontró que la co-infección por los tres endosimbiontes fue más común que la infección por un solo endosimbionte, para la cual el endosimbionte m´as frecuente fue Hamiltonella, per o este no se presentó en todas las localidades. Por su parte Portiera no fue el más frecuente pero se encontró en todas las localidades con una ocurrencia del 100% seguido por Hamiltonella (92%) y Rickettsia (88%). No se observó asociación de alguno de los endosimbiontes o combinaciones de estos con la región, localidad o cultivo de procedencia de su hospedero. Al observar los análisis filogenéticos en base al gen 16S rRNA se obtuvo que las secuencias de Rickettsia fueron todas idénticas, mientras que en Hamiltonella y Portiera se observaron diferencias para la secuencia de Natagaima para ambos endosimbiontes y la de Mariquita para Portiera, aunque en general son muy similares independientemente de la región.

LEER
Caracterización molecular de la resistencia en yuca (manihot esculenta crantz) al ataque del ácaro verde (mononychellus tanajoa) : una aproximación proteómica

Montoya Lerma, James | 2015

El ácaro verde, Mononychellus tanajoa (Acari: Tetranychidae), es una de las principales plagas de la yuca, causando daños directamente al chupar la savia. Aunque tiene una amplia distribución en América Latina, África y el alto potencial de extenderse a Asia, Indonesia y Oceanía, muy poca información está disponible para establecer un plan de manejo integrado de plagas. En consecuencia, los objetivos del presente estudio fueron: (1) cuantificar los efectos de los niveles de resistencia con bioensayos a libre y no libre escogencia para la preferencia de oviposición y (2) generar un amplio mapa del proteoma del tejido fotosintético de yuca utilizando la proteómica cuantitativa de etiquetado libre en diez genotipos del banco de germoplasma de yuca.

LEER
Checklist with a key to genera and subgenera of dung beetles (Coleoptera: Scarabaeidae: Scarabaeinae) present and supposed for Ecuador.

Chamorro, William | 2018-07-08

The beetles of the Subfamily Scarabaeinae are a group that have been used in taxonomic, ecological, natural history, biodiversity and conservation studies recently, as they are good indicators of habitat quality and due to their great genera and species richness. Their taxonomy is relatively well known, however new taxa and nomenclatural changes are frequently ocurring, mainly due to taxonomic revisions at the genus level. Currently in the Neotropics, 127 taxa (between genera and subgenera) are recorded, with 59 taxa belonging to 33 genera and 220 species (with 23 new records) present in Ecuador, and nine more genera that allegedly could be registered. With the aim of promoting the study and knowledge of this group in Ecuador, an identification key for the genera and subgenera present and/or supposed to be present in this country is provided in this work, which includes current taxa with Scarabaeinae (Coleoptera: Scarabaeidae) for the neotropic.

LEER
Chromosome numbers in insects of Argentina I. Cytogenetic characterization of 15 species with economic importance.

Páez, Valeria de los Angeles | 2020-07-09

In the present study, the somatic and gametic chromosome numbers in fifteen species of insects from Argentina are reported. Said species are characterized for their economic importance as pest of crops or as agricultural pest controllers. The species belonged to the following orders and families: Neuroptera, Chrysopidae: Ceraeochrysa cincta (n = 5 + XY), Ceraeochrysa paraguaria (n = 5 + XY), Chrysoperla argentina (n = 5 + XY), Chrysoperla asoralis (n = 5 + XY), Chrysoperla externa (n = 5 + XY), Leucochrysa cruentata (n = 7 + XY) y Plesiochrysa elongate (n = 5 + XY), Coleoptera, Coccinellidae: Cyclonela sanguinea (n = 9 + XYp), Eriopis connexa (n = 9 + XYp), Harmonia axyridis (n = 7 + XYp), Hippodamia convergens (n = 9 + XYp), y Melyridae: Astylus atromaculatus (n = 8 + XYp), Dermaptera, Forficulidae: Doru lineare (2n = 20) and D. luteipes (2n = 20), Diptera, Ulidiidae: Euxesta eluta (n = 5 + XY). Chromosomal information for six species and additional gametic chromosome number for Euxesta eluta are established for the first time. In addition, a new chromosome number is cited for Astylus atromaculatus that is different to the one previously reported.

LEER
Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.

Ramos Hernández, Eder | 2020-12-26

The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.

LEER
Comparison of the volatiles composition between healthy and buprestid infected Juglans regia (Juglandaceae).

Cui, Yaqin | 2020-07-09

Meliboeus ohbayashii primoriensis (Coleoptera: Buprestidae) is an important pest of the walnut tree Juglans regia (Juglandaceae), but the volatiles mediating this plant–herbivore interaction are unknown. In this study, volatiles emitted by healthy J. regia and by plants infested with M. ohbayashii primoriensis (Coleoptera: Buprestidae) were obtained by a dynamic headspace method and analyzed by gas chromatography-mass spectrometry (Shanxi, China). We identified 26 major compounds and compared the volatile composition of healthy and buprestid-infected J. regia. Green leaf volatiles were detected in all damaged plants, including the monoterpenoids β-phellandrene and (E)-β-ocimene, the sesquiterpenoids (-)-β-bourbonene, β-ylangene, and (E,E)-α-farnesene, the alcohols linalool, myrtenol, and (E)-(-)-pinocarveol, the ketones (E)-pinocamphone and (Z)-pinocamphone, and the ester methyl salicylate. The major volatiles detected in healthy plants were β-pinene (36.26 %), α-pinene (23.81 %), D-limonene (12.03 %), sabinene (8.63 %), and β-myrcene (4.35 %). The main volatiles from M. ohbayashii primoriensis larva-infested plants were β-pinene (37.82 %), α-pinene (20.36 %), D-limonene (14.71 %), germacrene D (5.24 %), sabinene (4.52 %), and β-phellandrene (3.80 %). These results enrich our understanding of volatiles of healthy plants and plants infested with M. ohbayashii primoriensis. Furthermore, they provide a theoretical basis and scientific foundation for integrated pest management and for effective ecologically sustainable pest control strategies

LEER
Composting to control the leaf-cutting ant Atta cephalotes L. (Hymenoptera: Formicidae)

Armbrecht, Inge | 2013-06-28

Las hormigas cortadoras de hojas, Atta y Acromyrmex, son los herbívoros más importantes en los trópicos. En este estudio se comparan los efectos de dos métodos no químicos sobre la sobrevivencia y actividad de nidos de Atta cephalotes (Formicidae:Myrmicinae). Un total de 83 nidos activos de A. cephalotes fueron asignados de forma aleatoria a uno de tres tratamientos: 1) incorporación de un material compostable al suelo; 2) remoción y mezcla de la capa superficial del suelo (método convencional) y 3) placebo o control (sin tratamiento). Después de tres meses, los porcentajes de nidos eliminados con cada uno de los tratamientos fueron 26,5; 9,6; y 3,6; respectivamente. Un análisis de varianza de medidas repetidas mostró una diferencia significativa entre las colonias de hormigas sometidas a los tratamientos compostado y remoción mecánica en relación con el placebo. Esto debido a la destrucción de las pistas de forrajeo, de las aberturas, cámaras y túneles. Sin embargo, el más fuerte efecto fue observado con el compostado. Basado en estos resultados sobre los nidos de A. cephalotes y su efecto potencial de enriquecer el suelo, el tratamiento compostado puede representar una práctica sustentable y ecológicamente amigable en el control de hormigueros de Atta.

LEER
¿Cómo responde la hormiga cortadora de hojas Atta Cephalotes (Hymenoptera : Myrmicinae) a la remoción mecánica de sus nidos?

Montoya Correa, Mavir | 2011-10-06

En Colombia, eventualmente, se utiliza la excavación y extracción de la reina de los nidos para eliminar sociedades incipientes de la hormiga cortadora de hojas Atta cephalotes. Sin embargo, no es claro si éste controla colonias ya establecidas (mayores que 30 cm de diámetro). Este estudio se dirigió a determinar cómo responde la hormiga cortadora de hojas a la remoción mecánica del suelo y cámaras de cría de sus nidos, sin búsqueda activa de la reina. En el campus de la Universidad del Valle, Meléndez, se seleccionaron 53 nidos, con tamaños entre 0.85 y 79.31 m2. En un diseño en bloques completamente aleatorio, 30 se trataron mecánicamente y 23 se dejaron como testigo (sin perturbación). Durante tres meses consecutivos se midieron las variables área superficial del nido, área de bocas, soldados en defensa y ancho de pistas activas y los datos fueron comparados con medidas obtenidas antes de la intervención. La mortalidad de nidos al finalizar el estudio fue del doble para el tratamiento remoción mecánica comparada con el testigo. Aunque en los dos primeros meses se observó disminución en las variables respuesta en el tratamiento mecánico, ésta no fue sostenida y varios nidos se recuperaron al último mes de evaluación. Es posible que este método, aplicado regularmente, permita controlar nidos pequeños y medianos (producto de la muerte de la reina) pero debe ser complementado con otros métodos. Además, de resultar efectivo, sería poco costoso y eventualmente podría generar empleo y sensibilidad entre los pobladores del campo y la ciudad.

LEER
Depredadores de escarabajos de la corteza (Coleoptera) en la región de Balikesir de Turquía.

Huseyin Cebeci, Haci | 2018-12-31

El objetivo de este estudio fue determinar la diversidad de los depredadores de los escarabajos de la corteza en los bosques de coníferas de la provincia de Balıkesir en Turquía. Se establecieron seis parcelas que contenían cinco trampas de feromonas y dos trampas de troncos. Se encontraron ocho especies de depredadores de escarabajos de corteza: Aulonium ruficorne (Olivier, 1790), Clerus mutillarius Fabricius 1775, Corticeus fraxini (Kugelann, 1794), Paromalus parallelepipedus (Herbst, 1792), Platysoma elongatum (Thunberg, 1782), Raphidia ophiopsis Linnaeus 1758, Temnochila caerulea (Olivier, 1790) y Thanasimus formicarius (Linnaeus, 1758), pertenecientes a seis familias: Cleridae, Trogossitidae, Laemophloeidae, Tenebrionidae, Zopheridae, Histeridae, Raphidiidae. También se describe en cuáles galerías de escarabajos se encontraban estos depredadores.

LEER

‹›

Browsing by Author "Montoya Lerma, James"

A proposal of a conceptual framework for the development of entomology research projects and related sciences. ﻿

Abundancia y preferencia trófica de dichotomius belus (coleoptera : scarabaeidae) en la Reserva Forestal de Colosó, Sucre. ﻿

Acaricidal activity and repellency of Blechnum cordatum (Blechnaceae) against Tetranychus urticae (Acari: Tetranychidae). ﻿

Actividad disuasiva y biocida de Salvia officinalis con inducción de malformaciones en Aedes aegypti (Diptera : Culicidae). ﻿

Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides. ﻿

Ants (Hymenoptera: Formicidae) of Durango, México. ﻿

Arthropod pests and their management, natural enemies and flora visitors associated with castor (Ricinus communis), a biofuel plant: a review. ﻿

Arthropods associated with Callisthene fasciculata (Vochysiaceae) canopy in the Pantanal of Mato Grosso, Brazil. ﻿

Associated entomofauna with edible canna crops Canna indica (Cannaceae) in three areas of Colombia. ﻿

Boquillas de pulverización hidráulicas para la aplicación de nematodos entomopatógenos. ﻿

Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge. ﻿

Caracterización de tres endosimbiontes de la mosca blanca: Bemisia tabaci (Hemiptera: Aleyrodidae) de Colombia ﻿

Caracterización molecular de la resistencia en yuca (manihot esculenta crantz) al ataque del ácaro verde (mononychellus tanajoa) : una aproximación proteómica ﻿

Checklist with a key to genera and subgenera of dung beetles (Coleoptera: Scarabaeidae: Scarabaeinae) present and supposed for Ecuador. ﻿

Chromosome numbers in insects of Argentina I. Cytogenetic characterization of 15 species with economic importance. ﻿

Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV. ﻿

Comparison of the volatiles composition between healthy and buprestid infected Juglans regia (Juglandaceae). ﻿

Composting to control the leaf-cutting ant Atta cephalotes L. (Hymenoptera: Formicidae) ﻿

¿Cómo responde la hormiga cortadora de hojas Atta Cephalotes (Hymenoptera : Myrmicinae) a la remoción mecánica de sus nidos? ﻿

Depredadores de escarabajos de la corteza (Coleoptera) en la región de Balikesir de Turquía. ﻿

Envíos recientes

A proposal of a conceptual framework for the development of entomology research projects and related sciences.

Abundancia y preferencia trófica de dichotomius belus (coleoptera : scarabaeidae) en la Reserva Forestal de Colosó, Sucre.

Acaricidal activity and repellency of Blechnum cordatum (Blechnaceae) against Tetranychus urticae (Acari: Tetranychidae).

Actividad disuasiva y biocida de Salvia officinalis con inducción de malformaciones en Aedes aegypti (Diptera : Culicidae).

Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides.

Ants (Hymenoptera: Formicidae) of Durango, México.

Arthropod pests and their management, natural enemies and flora visitors associated with castor (Ricinus communis), a biofuel plant: a review.

Arthropods associated with Callisthene fasciculata (Vochysiaceae) canopy in the Pantanal of Mato Grosso, Brazil.

Associated entomofauna with edible canna crops Canna indica (Cannaceae) in three areas of Colombia.

Boquillas de pulverización hidráulicas para la aplicación de nematodos entomopatógenos.

Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge.

Caracterización de tres endosimbiontes de la mosca blanca: Bemisia tabaci (Hemiptera: Aleyrodidae) de Colombia

Caracterización molecular de la resistencia en yuca (manihot esculenta crantz) al ataque del ácaro verde (mononychellus tanajoa) : una aproximación proteómica

Checklist with a key to genera and subgenera of dung beetles (Coleoptera: Scarabaeidae: Scarabaeinae) present and supposed for Ecuador.

Chromosome numbers in insects of Argentina I. Cytogenetic characterization of 15 species with economic importance.

Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.

Comparison of the volatiles composition between healthy and buprestid infected Juglans regia (Juglandaceae).

Composting to control the leaf-cutting ant Atta cephalotes L. (Hymenoptera: Formicidae)

¿Cómo responde la hormiga cortadora de hojas Atta Cephalotes (Hymenoptera : Myrmicinae) a la remoción mecánica de sus nidos?

Depredadores de escarabajos de la corteza (Coleoptera) en la región de Balikesir de Turquía.

A proposal of a conceptual framework for the development of entomology research projects and related sciences.

Abundancia y preferencia trófica de dichotomius belus (coleoptera : scarabaeidae) en la Reserva Forestal de Colosó, Sucre.

Acaricidal activity and repellency of Blechnum cordatum (Blechnaceae) against Tetranychus urticae (Acari: Tetranychidae).

Actividad disuasiva y biocida de Salvia officinalis con inducción de malformaciones en Aedes aegypti (Diptera : Culicidae).

Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides.

Ants (Hymenoptera: Formicidae) of Durango, México.

Arthropod pests and their management, natural enemies and flora visitors associated with castor (Ricinus communis), a biofuel plant: a review.

Arthropods associated with Callisthene fasciculata (Vochysiaceae) canopy in the Pantanal of Mato Grosso, Brazil.

Associated entomofauna with edible canna crops Canna indica (Cannaceae) in three areas of Colombia.

Boquillas de pulverización hidráulicas para la aplicación de nematodos entomopatógenos.

Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge.

Caracterización de tres endosimbiontes de la mosca blanca: Bemisia tabaci (Hemiptera: Aleyrodidae) de Colombia

Caracterización molecular de la resistencia en yuca (manihot esculenta crantz) al ataque del ácaro verde (mononychellus tanajoa) : una aproximación proteómica

Checklist with a key to genera and subgenera of dung beetles (Coleoptera: Scarabaeidae: Scarabaeinae) present and supposed for Ecuador.

Chromosome numbers in insects of Argentina I. Cytogenetic characterization of 15 species with economic importance.

Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.

Comparison of the volatiles composition between healthy and buprestid infected Juglans regia (Juglandaceae).

Composting to control the leaf-cutting ant Atta cephalotes L. (Hymenoptera: Formicidae)

¿Cómo responde la hormiga cortadora de hojas Atta Cephalotes (Hymenoptera : Myrmicinae) a la remoción mecánica de sus nidos?

Depredadores de escarabajos de la corteza (Coleoptera) en la región de Balikesir de Turquía.