Revista Colombiana de Entomología

|

Quantitative biological response of two predators (Heteroptera: Notonectidae) in the larval control of Aedes aegypti (Diptera: Culicidae).

Ayala Sulca, Yuri Oliver | 2021-07-22

Predation is a biotic factor that influences the structure and functioning of ecosystems, its effect can be quantified through functional (FR) and numerical response in a successful-invasion context. We use FR to understand the coevolutionary relationships, and measured the biological response of the predators Notonecta peruviana and Buenoa fasciata in the control of fourth-stage larvae of Aedes aegypti (F1) at different densities (5, 10, 20, 35, 55 and 80 larvae / liter). Fasting predators (48 hours) were introduced to the test containers (one individual per species) and the FR, the number of preys consumed (Ne), the attack coefficient (a) and handling time (Th). N. peruviana and B. fasciata developed a type II FR in the consumption of larvae of Ae. aegypti (p ≤ 0.01), and occupied close handling times (Th) (t = –1.93; df = 12; p = 0.078). N. peruviana preyed (Ne) twice as many larvae of Ae. aegypti (p ≤ 0.05) and showed a higher attack coefficient (a) in relation to B. fasciata (t = 14.92; df = 12; p = 0.000). The predators N. peruviana and B. fasciata rapidly destabilized and consumed the preys. N. peruviana preyed twice as many larvae, attributable to the recent predator-prey effect compared to the possible coevolutionary adjustment between B. fasciata and Ae. aegypti. It would be important to consider the predator species in the vector control programs for aedine mosquitoes.

Fluctuation of Premnobius cavipennis (Coleoptera: Curculionidae: Scolytinae) populations in balsa (Ochroma pyramidale) plantations in the central zone of the Ecuadorian Littoral.

Averos, Joselyn Briggite | 2021-02-03

This study aimed to determine the population fluctuation of Premnobius cavipennis and the effect of the trap height on balsa plantations (Ochroma pyramidale). The research was in El Vergel, El Empalme, and Guapara, three localities of Ecuador. There were used flight-interception traps with alcohol as an attractant, placed at one, four, and eight meters high. The collection and evaluation were carried out every week, for one year by locality. Premnobius cavipennis showed a population fluctuation throughout the year, with population peaks in months of the rainy season in the three locations. In El Vergel, the greatest abundance of P. cavipennis was found with 2,382 individuals, showing a population maximum in December. In El Empalme 1,263 individuals were captured, with population increases in January and April. In Guapara 525 individuals were registered, showing a population increase in March. There were captured individuals of P. cavipennis in the three heights of the traps in the three locations. There were highly significant differences between the heights, with a greater effect on the capture at one meter in the three locations of individuals at one meter, behavior that was the same in the three locations.

Diversity of epigeal coleopteran in hualo forests and insigne pine plantations in central Chile.

Huerta Fuentes, Amanda Isabel | 2021-02-03

Hualo forests (Nothofagus glauca) endemic from Chile have been impacted by anthropic processes such as substitution by exotic plantations of ensigned pine (Pinus radiata). The diversity of epigeous Coleoptera in Hualo forests, highly sensitive to changes, has been scarcely documented in Chile. It was evaluated the seasonal diversity of epigeous Coleoptera in three habitats (hualo forests, pine plantations, and mixed formations of pine plantations and hualo forests) in the area of Constitución, central Chile. During the spring and summer were established three random linear transects of 100 m in three mature stands of each habitat, where 10 pitfall traps were installed every 10 m. For each habitat, the composition, abundance, and richness of epigeous beetles were estimated. The diversity of species was calculated per season using the Shannon-Wiener (H’), Pielou (J’), Chao 2, and Jacknife 1 indexes. Besides, rarefaction curves were built to estimate the expected richness. Nineteen Coleoptera native species belonging to 11 families were detected. In spring, the relative abundances of Coleoptera were significantly higher in pine plantations, followed by mixed formations and hualo forests. In summer, although the abundance was reduced, the predominance in the pine plantations remained stable. The relative richness in pine plantations and hualo forests was similar and superior to mixed formations in summer. However, it was inferred from the rarefaction curves, that only the sampling effort in summer was appropriated. The H’ index was higher in mixed formations in spring, and in N. glauca forests in summer, coinciding with the highest J’. The results suggest that maintaining pine plantations, favors the conservation of epigeous Coleoptera, acting as reservoirs of biodiversity, possibly due to the greater tree cover and understory, in this particular habitat.

Land use and terrestrial arthropods at the Colombian Pacific coast.

Löhr, Bernhard | 2021-02-03

Diversity, permanence, and activity of terrestrial arthropods were investigated in four areas of different land use in the lowlands of the Pacific coast of Colombia with the aim to identify potential predator species for the palm root borer, Sagalassa valida. Ten pitfall traps were established along a 100 m transect in four areas: a secondary forest, a 20 year.-old peach palm plantation, and two hybrid oil palm plantations of three and seven years of age, respectively. Twenty-two collections were made covering a whole year. All ants were identified to species or morphospecies level, the other arthropods to order or where possible to family level. In total, 50,603 arthropods were captured, the most abundant were ants (37.0 %), followed by Collembola (35.4 %), Acari (10.6 %), Coleoptera (7.0 %) and Diptera, Hemiptera and Araneae in almost equal numbers (around 2.5 %). Orthoptera (92 % Gryllidae) were present in all collections, always at low numbers. The highest number of ants were recorded in the oil palm transects; Diptera, Hemiptera and Orthoptera were more numerous in the secondary forest, Acari, Araneae and Collembola in the palm transects. Ectatomma ruidum was by far the dominant ant species (84.9 % of all specimens) and absent from only 20 of the 880 captures. The second most frequent ant genus were army ants with two species, Labidus praedator and L. coecus. Rainfall, even area-wide flooding, and temperature did not explain variability in captures of any taxonomic group satisfactorily. We conclude that E. ruidum might be the predator to provide control of the root borer and recommend further studies on its efficiency.

Temperature effect on the phenotypic expression of characters of costal spots Nyssorhynchus triannulatus (Diptera: Culicidae: Anophelinae).

González Obando, Ranulfo | 2021-03-03

In this study, the effect of temperature on the phenotypic expression of size, elongation (length/width) and costal wing spots among families, progenies and sexes was evaluated through traditional morphometry in populations of Nyssorhynchus triannulatus from southern Colombia. In the progenies of 11 families, obtained at 20, 24 and 28 °C the wings showed four costal spots patterns. Pattern I was present in all three breeding temperatures with the highest frequency. Within families, the average length/width of wing ratio was significantly higher in males than females, while the variation by sex of this character was similar. Among the families, the temperature had variable influence on the sizes of wings and costal spots. Within the components of phenotypic variation, the breeding temperature had no significant detectable effect on the length of the wing and several of the analyzed characters; however, the proportion of the subcostal pale spot length over the length of the distal sector dark spot (SCP/DSD) was the most sensitive to temperature changes. The genetic contribution of the wing size and the measured characters length, as well as the effect of the families (origin) on the phenotypic variation, was significant for almost all the characters analyzed. The effect of the sexes on the phenotypic variation of the studied characters was significant only for some characters, while there were few significant interactions between the three factors analyzed (temperature, family and sex) with a low effect on the phenotypic variation.

Bottom-up effects on arthropod communities in Platycyamus regnellii (Fabaceae) fertilized with dehydrated sewage sludge.

Fernandes de Souza, Gezilene | 2021-02-03

Sewage sludge is a nitrogen-rich organic compound, which can be used to aid development in plants such as Platycyamus regnellii (Fabaceae), in the recovery of degraded areas. This study aimed to assess the bottom-up effects on leaf mass and percentage of ground cover (leaf litter, herbaceous plants, and grasses) in P. regnellii trees fertilized (or not) with dehydrated sewage sludge and arthropod communities over 24 months. Platycyamus regnellii trees fertilized with dehydrated sewage sludge presented significantly more leaves per branch, branches per tree, and a higher percentage of ground cover compared to unfertilized trees. Phenacoccus sp. (Pseudococcidae) was the most abundant phytophagous insect associated with P. regnellii trees. Fertilization did not affect the abundance, diversity, and species richness of Hemiptera phytophagous on P. regnellii trees. However, fertilized trees presented higher abundance and species richness of trophobiont-tending ants compared to unfertilized trees, with Camponotus sp. being the most abundant regardless of the treatment. Fertilized P. regnellii trees also presented higher species richness of natural enemies compared to unfertilized ones, with Aranae and Dolichopodidae being the most abundant. We concluded that fertilization with dehydrated sewage sludge improved P. regnellii trees leaf mass and ground cover and increased the diversity of trophobiont-tending ants and natural enemies. To our knowledge, this is the first study on the arthropods community associated with this tree species. This suggests that upon fertilization, P. renellii trees are useful for ecological restoration in severely disturbed areas.

Effect of climatic factors, plant varieties, and planting densities on arthropod dynamics in rice crops in Yopal - Casanare, Colombia.

Obregon, Diana | 2021-02-03

The diversity and population dynamics of the arthropods present in rice crops under dry and irrigated planting systems were evaluated, with two rice varieties (Fedearroz 174 and Fedearroz 733), and in three planting densities (60, 100, and 180 kg/ha) in relation to different climatic variables. For specimen collection, 10 double entomological net passes were performed every eight days from emergence to the start of the maturation phase. The morphotypes found were identified and grouped according to their type of interaction with the crop in sap-suckers, chewers, predators, and parasitoids. The most relevant climatic variables were selected with a Random Forest analysis. 126 morphotypes were identified in 12 orders. The greatest richness was found in Hemiptera, Coleoptera and Diptera, as well as in the group of suckers. No differences were found in the abundance or richness of arthropods between varieties or planting densities. The irrigation system presented a greater total abundance of arthropods compared to the rainfed system, but in this system, there was higher species richness. Parasitoid and predator populations were negatively correlated with chewers but there was no effect on sap-suckers. Temperature and relative humidity were the most relevant climatic variables in arthropod dynamics. These results contribute to develop pest monitoring and management systems that take into account the dynamics of interaction between ecological groups and the effect of local climate.

Thermal requirements of Trichogramma pretiosum (Hymenoptera: Trichogrammatidae) lines in Neoleucinodes elegantalis (Lepidoptera: Crambidae) eggs.

Ramos Coutinho, Cristiane | 2021-02-03

This study aimed to evaluate the impact of temperature on the development of two lines of Trichogramma pretiosum (Hymenoptera: Trichogrammatidae), to determine the thermal requirements of this parasitoid wasp on Neoleucinodes elegantalis (Lepidoptera: Crambidae) eggs. The experiment was carried out with two lines (“Ubajara” and “Guaraciaba”, Ceará State) of T. pretiosum collected naturally parasitizing eggs of N. elegantalis in tomato (Solanum lycopersicum) fruits. In this experiment, 40 eggs of the host N. elegantalis and 4 females of the parasitoids were used, with exposure to parasitism for 24 hours at 25 ± 1 °C, relative humidity of 70 ± 10 %, and 12-h photophase. At the end of this period, females were removed and the tubes were transferred to incubators (RH = 70 ± 10 %; 12-h photophase), exposed to 15, 20, 25, 30, or 35 °C, until emergence of the following generation of the parasitoids. The percentage of emergence, sex ratio, the number of parasitoids that emerged per egg, and cycle duration were assessed. The experiments were set up in a completely randomized experimental design with 5 treatments (temperatures) and 12 replicates. ANOVA was conducted and the means were compared by Tukey test (P < 0.05). The base temperatures were 10.77 °C and 10.86 °C and the number of generations per year were 33.29 and 35.63 for “Ubajara” and “Guaraciaba”, respectively. The study showed that temperature changed the biological parameters, and cycle duration of the “Ubajara” and “Guaraciaba” lines decreased as temperature increased.

Systematics and diversity of Neotropical ants.

Fernandez, Fernando | 2021-02-03

With a long history of more than 100 million years and about 14,000 described living species, ants are one of the most important and well-known groups of insects in the world. Ants are key elements in the structure and dynamics of terrestrial systems, especially in the tropics, as well as models in studies of evolution, ecology, and monitoring of disturbed ecosystems. For all this, it is essential to know their history and phylogeny, in order among other things, to have a solid base for their systematics and taxonomy. Within Aculeata ants appear to be the sister group of Apoidea, and the ancestor of the Formicidae may have inhabited the northern hemisphere during the early Cretaceous. Since then, and especially since the Eocene, ants have spread throughout the planet, occupying almost all environments from forests to deserts. The Neotropical region has 137 genera and around 3,100 species of ants. The Neotropics seem to have been the “cradle” and “museum” of the groups of ants, which would explain their great diversity and a high degree of endemisms. This review describes the current state of knowledge of ants in the Neotropical region from a systematic point of view, with a synopsis of all supraspecific taxa described to date. Critical genera, problems to be solved, and perspectives for the study of these insects are also presented.

Use of andiroba oil to control Anastrepha fraterculus (Diptera: Tephritidae) in different fruit hosts.

Wille, Cleiton Luiz | 2021-02-03

Control of Anastrepha fraterculus (Diptera: Tephritidae) is usually accomplished with synthetic insecticides, which can be a problem considering exportation of fruits. This study aimed to evaluate mortality and offspring effects on A. fraterculus using peach, strawberry guava and apple fruits treated with andiroba (Carapa guianensis) oil. Higher mortality rate was observed when compared to control on strawberry guava and apple fruits treated with andiroba oil (18.4 % and 35.0 % points more than the control). The mean number of pupae observed in the offspring was inferior to the control on strawberry guava and apple fruits treated with andiroba oil (100 % control) and, on peach fruits (68.3 % fewer pupae). Andiroba oil shows promising results as an alternative product to control A. fraterculus. Studies are still needed especially considering the effectiveness of andiroba oil under field conditions.

Use of generalized linear models in the Leptopharsa gibbicarina (Hemiptera: Tingidae) count in oil palm.

Mesa Fúquen, Eloina | 2021-02-03

The analysis of data coming from the counting of events must consider tools that are appropriate to deal with this type of variable. A valid approach to cope with this task consists of using the Generalized Linear Model (GLM). The use of GLM allows working with density functions such as Poisson or Negative Binomial. This work presents the results of analyzing the data from an experiment carried out at the Research Station of Cenipalma located in the municipality of Barrancabermeja (Colombia). The experiment was established to evaluate, at the field level, the entomopathogenic fungus Purpureocillium lilacinum as a strategy to control the population of the lace bug, Leptopharsa gibbicarina. The experiment was carried out in two plots, in one of them, the control of L. gibbicarina with P. lilacinum was implemented as suggested by the Entomology research program of Cenipalma and, in the other plot there was no control strategy. The data were analyzed by using GLM and two different density functions (Poisson and the negative binomial). Results showed statistically significant differences between the treatments. The estimator of the maximum likelihood associated with the P. lilacinum treatment indicated that the application of the entomopathogenic fungus reduced the populations of L. gibbicarina with a rate of incidence of 0.28 times more than the control.

Toxicological and behavioral impacts of atrazine on Trichogrammatidae (Hymenoptera) in choice tests.

Demolin Leite, Germano Leão | 2021-02-03

Weeds should be controlled with low impact methods and selective agrochemicals that have little or no effect on non-target organisms. This study aimed to evaluate the effect of the herbicide atrazine (triazine class) on 10 Trichogrammatidae (Hymenoptera) species. A female of 10 species of these natural enemies was individually placed in a glass test tube (free-choice test) with two paper cards containing 45 Anagasta (Ephestia) kuehniella (Lepidoptera: Pyralidae) eggs (treatment and control), with 10 replications. The cards were sprayed with the herbicide atrazine at 8.07 L/ha; the control was sprayed with distilled water. Parasitism by these natural enemies was allowed for 48 h. Atrazine changes the behavior of female parasitoids, reducing the parasitism (≈ 71 %) and emergence (≈ 74 %) rates and sex ratio (≈ 74 %) of the Trichogrammatidae species, except for Trichogramma galloi and T. bennetti. No females emerged from eggs parasitized by T. acacioi, Trichogrammatoidea annulata, T. atopovirilia, T. bruni, T. brasiliensis, T. demoraesi, and T. soaresi with atrazine. The results revealed that atrazine herbicide is harmless to T. bennetti and T. galloi, but it was moderately harmful (80 – 99 % reduction) to the other Trichogrammatidae species based on the parasitism and emergence rates.

Incidence of pests in post-harvest material of nine export-type hydrangea cultivars in Antioquia (Colombia).

Molina Acosta, Maria Daniela | 2021-02-03

Floriculture in Colombia has great economic and social impact bringing important profit to the sector for more than 40 years. Recently, the hydrangeas flower market have the largest growths in cultivated areas and exported product, but they also have the highest rates of interceptions at the international ports. Even so, few information about the main pests affecting crops, areas or cultivars has been published. This study evaluated the pests captured on hydrangeas’ flowers inspected in a trading company of the Eastern region of Antioquia. A total of 6,272 samples (31,360 flowers), of nine cultivars from 86 farms in six municipalities collected during five months were used. The 8.61 % of the samples had at least one limiting-pest specimen for exportation. The most frequent arthropods were mites, eggs and motile stages, and in less frequency aphids, thrips and slugs. The most affected cultivars were those with blue flowers. The 90 % of the farms (n = 86) had at least one event of interception, although there was no spatial pattern associated with municipality. Our data suggest that the interceptions by quarantine pests were associated with the crop and post-harvest management rather than their geographic location or cultivars. This work provides, for the first time, information of the pests with highest incidence in exporting-type Hydrangeas. Although there is no information about the incidence of hydrangeas pests in the crops, these results could help to identify priority areas and cultivars for inspection and evaluation in the field.

Spatial distribution of the Mexican fruit fly complex (Anastrepha spp.) (Diptera: Tephritidae) in Michoacán, México.

Vanegas Carrillo, Ricardo | 2021-02-03

Globally, fruit production is one of the main sources of income since it generates large economic spills for producers, however, it is affected by various pests. In Mexico, the Mexican fruit fly is one of the main pests that cause considerable economic damage. Fruit oviposited by this pest usually is no longer accepted in the market causing large economic losses to the producers. The alternative controls against this pest have been ineffective due, among other causes, to the fact that their spatial distribution within plum, orange, sapote, guava and mango orchards is unknown. Therefore, this work aimed to determine the spatial distribution of the Mexican fruit fly populations in these orchards, through the application of spatial statistics techniques and the generation of maps through "kriging". The results showed that populations of this fruit pest have an aggregate distribution, which was corroborated by density maps. Infestations were distributed in different areas of the orchards, which would be useful to direct control measures on specific areas of infestation.

Updated status of whiteflies (Hemiptera: Aleyrodidae) in Jordan with emphasis on the Bemisia tabaci species complex.

Ghabeish, Ihab | 2021-02-03

Whiteflies are economically important plant pests that cause damage to crops worldwide. This study aimed to update the status of whiteflies in Jordan by combining the classical morphological identification and the DNA markers using the mitochondrial cytochrome oxidase I (mtCOI) gene. Over the course of three consecutive years, 111 whiteflies were collected from different geographical regions and different plant hosts in Jordan. The results showed that, in addition to Bemisia tabaci, another nine different whitefly species were identified, including two species that were recorded for the first time in Jordan: Africaleurodes coffeacola, and Tetraleurodes neemani. A special focus has been given to economically important plant pests like the B. tabaci species complex. Three different diagnostic techniques were used to identify B. tabaci putative species based on mtCOI gene. All the collected samples of B. tabaci species complex were identified as Middle East–Asia Minor 1 (MEAM1) putative species.

Population fluctuation and parasitism of Aleurothrixus floccosus (Hemiptera: Aleyrodidae)in citrus trees from Atacama Desert, Chile.

Tello Mercado, Víctor | 2021-02-03

The effect of three different types of crop management on parasitism of Aleurothrixus floccosus in the Atacama Desert was studied. The studied parasitoids were: Cales noacki, Eretmocerus paulistus, Amitus spiniferus, and the hyperparasitoid Signiphora sp. The study was performed in Pica Oasis, located in the Atacama Desert, Tarapacá region, Chile, from February 2009 until February 2011. Three orchards were selected based on the type of plantation: the Bajo Miraflores Sector with plantation frames (5 x 5 m) and pruning management; the San Lorenzo Sector without plantation frames or pruning management; and Miraflores Sector that represents a mixed system between both of them. Two sampling procedures were applied. One was of the absolute type, in which 36 leaves per tree were collected from four labeled trees that were sampled twice a month, and the other was collected through yellow sticky chrome-attracting traps set in the central part of each of the labeled trees used for absolute sampling. The results indicate that in the Oasis of Pica, the different stages of A. floccosus are distributed throughout the year; with all stages represented during every month. The three sampled sectors exhibited different population levels of A. floccosus. The hyperparasitoid Signophora sp. presented the highest population density. The average parasitism percentage of A. floccosus in Pica was lower than 15 %.

Differences in optical properties of males and females pupae of Anastrepha fraterculus (Diptera: Tephritidae).

Mundstock Jahnke, Simone | 2021-02-03

One alternative to pesticide-based control of important fruit fly (Tephritidae) species is the sterile insect technique (SIT). SIT is based on mass releases of sterile males (subjected to radiation) to control a given pest population. For several important species such as Rhagoletis pomonella, Bractocera oleae and Anastrepha fraterculus, a technical challenge is to differentiate males from females in the pupal stage. Although for some species sterile females are released in the field, it is not desirable to release females from Anastrepha spp. as puncture damage may occur. Therefore, we investigated hyperspectral and RGB imaging to classify the sex in A. fraterculus pupae. We aimed to discriminate, through the description of RGB spectra and hyperespectral profiles, males and females in different stages of pupal development. Images of pupae of different degree-day (DD) development times were obtained. The hyperspectral profiles pupae of 288, 345 and 403 DD showed differences, indicating that pupal hue is altered throughout the development. In the NIR spectrum (800 to 1,700 nm), a higher reflectance between 1,100 and 1,400 nm was observed. In these bands differences in the spatial standard deviation of reflectance between males and females occur. As for the RGB images we observed differences in radiometric variation angle from the top to the basal part of the pupae. For females the radiometric variation angle was greater (26°) than for the males (15°). Thus, it is possible to determine discriminatory characteristics using the spectral profiles, imaging techniques and data analysis to discriminate the sexes.

Repellency of adults of whitefly Trialeurodes vaporariorum (Heteroptera: Aleyrodidae) with clove and pipper.

Aguilar Astudillo, Eduardo | 2020-12-26

The whitefly Trialeurodes vaporariorum, an economically important pest in vegetables, is managed with synthetic pesticides and has generated resistance with adverse effects on the environment. In the search for alternative management, adult repellence with raw extracts (methanol, ethanol, dichloromethano, and hexane) essential oils, and major compounds of clove and pepper was tested. For this, a treated tomato leaf was placed at concentrations of 1.0 to 0.000001 % within a 1 L beaker containing a 10 mL flask with water. Subsecuently, 20 adults of 2 d of age were introduced. After 3 to 72 h, the posed adults were quantified, and repellence was determined from the difference. The raw extracts, essential oils, and major compounds of clove and pepper repel from 32.5 to 90.2 % of the adult population in 3 to 72 h. The cloves and pepper EO have a better repellent effect than raw extracts and secondary compounds, since they manage to repel 46.2 % to 100 %. The clove EO at the concentration of 1.0 % achieves 100 % repellency at 48 and 72 h after application, while the pepper EO reaches 97.5 % at 72 h after application; in practice, ethanolic crude extract of both plants should be used at a concentration of 0.000001 % since they can repel 38.7 to 87.5 % of adults, from 3 to 72 h, and its repellent effect is maintained; also, it is easier to acquire, safer for the operator, distributor and consumer; and is considered a solvent for the extraction of secondary compounds in organic farming standards.

Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.

Ramos Hernández, Eder | 2020-12-26

The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.

Alternative hosts and standardization of methods to evaluate the biocontrol activity of mycoinsecticides.

Torres Torres, Lissette | 2020-12-26

The entomopathogenic fungi Metarhizium anisopliae (Ascomycota: Clavicipitaceae) and Beauveria bassiana (Ascomycota: Cordycipitaceae) are an alternative for the control of grassland pests (e.g. Rhammatocerus schistocercoides (Orthoptera: Acrididae) and soybean pests (e.g. Cerotoma tingomariana; Coleoptera: Chrysomelidae). To use these microorganisms as active principles of micoinsecticides, it is necessary to have quality control methods (microbiological, physicochemical and biological activity) accuracy, and reproducibility in a given timeframe. For this reason and given the difficulty in obtaining individuals in the field and in the establishment of the rearing of R. schistocercoides and C. tingomariana, we established methods for the routine evaluation of biological activity using alternative hosts. For M. anisopliae directed to the control of R. schistocercoides, the model insects Diatraea saccharalis (Lepidoptera: Crambidae) and Spodoptera frugiperda (Lepidoptera: Noctuidae) were tested, and for B. bassiana directed to the control of the target insect C. tingomariana, the model insects D. saccharalis and Chloridea virescens (Lepidoptera: Noctuidae) were evaluated. D. saccharalis and C. virescens were selected as alternative insects to evaluate the efficacy of M. anisopliae and B. bassiana, respectively. Efficacy was close to 80 % for both pathogens. The methods with the selected alternative insects were standardized and showed that they are repeatable and reproducible under the evaluated conditions