• Español
  • English
  • Iniciar sesión
    o
    ¿Has olvidado tu contraseña?
Logotipo del repositorioBiblioteca Digital
  • Inicio
  • Comunidades
  • Navegar
  1. Inicio
  2. Examinar por materia

Examinando por Materia "Derbidae"

Mostrando 1 - 1 de 1
Resultados por página
Opciones de ordenación
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.
    (Universidad del Valle, 2020-12-26) Ramos Hernández, Eder; Lesher Gordillo, María Juliana; Ortiz García, Carlos Fredy; Oropeza Salín, Carlos; Sánchez Soto, Saúl; Magaña Alejandro, Miguel Ángel; Narváez C., María del S.; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.
Universidad del Valle
Universidad del Valle
  • Cali - Colombia
  • © 1994 - 2023
Dirección:
  • Ciudad Universitaria Meléndez
  • Calle 13 # 100-00
  •  
  • Sede San Fernando
  • Calle 4B N° 36-00
PBX:
  • +57 2 3212100
Línea gratuita PQRS
  • 018000 220021
  •  
Apartado Aéreo
  • 25360
Redes Sociales:
La Universidad
  • consejo-superior

    Consejo Superior
  • consejo-academico

    Consejo Académico
  • rectoria

    Rectoría
  • Nuestros Símbolos
  • acerca-de-univalle

    Acerca de Univalle
  • dependencias

    Dependencias
  • Museos

    Museos y Colecciones
  • Fotos de la Universidad
  • Mapa del Campus
  • tour-por-la-universidad

    Tour por la Universidad
  • daca

    Normatividad
  • horarios-de-atencion

    Horarios de atención
  • Portal de niños
  • Política de Tratamiento de
    la Información Personal
  • Accesibilidad digital
Estudia en Univalle
  • pregrado

    Pregrado
  • Postgrado
  • cursos-y-talleres

    Educación contínua
Sedes Regionales
  • Tuluá
  • Buga
  • univallecaicedonia

    Caicedonia
  • Cartago
  • Norte del Cauca
  • Pacífico
  • Palmira
  • Yumbo
  • zarzal

    Zarzal
  • Regionalización
Investigación
  • Acerca de la Vicerrectoría de investigaciones
  • Institutos, Centros y Grupos
  • Convocatorias
  • Universidad - Empresa (OTRI)
  • Dirección de Relaciones Internacionales
  • Programa Editorial
Internacionalización
  • Convocatorias

    Convocatorias
  • Estudia en Univalle

    Estudia en Univalle
  • Estudia

    Estudia en el exterior
  • Convenios

    Convenios Internacionales
  • Investiga

    Investiga en Univalle
  • Solicitudes

    Solicitudes / Trámites
  • About

    About Univalle
  • Contactos

    Contactos
Publicaciones
  • Libros
  • Periódico campus

2024 Universidad del Valle - Vigilada MinEducación

Sistema DSPACE 7 - Metabiblioteca | logo