• Español
  • English
  • Iniciar sesión
    o
    ¿Has olvidado tu contraseña?
Logotipo del repositorioBiblioteca Digital
  • Inicio
  • Comunidades
  • Navegar
  1. Inicio
  2. Examinar por materia

Examinando por Materia "Hemiptera"

Mostrando 1 - 5 de 5
Resultados por página
Opciones de ordenación
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.
    (Universidad del Valle, 2020-12-26) Ramos Hernández, Eder; Lesher Gordillo, María Juliana; Ortiz García, Carlos Fredy; Oropeza Salín, Carlos; Sánchez Soto, Saúl; Magaña Alejandro, Miguel Ángel; Narváez C., María del S.; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    Effect of mating on ovary maturation in Dactylopius coccus (Hemiptera: Coccoidea: Dactylopiidae).
    (Universidad del Valle, 2019-12-31) Ramírez Cruz, Arturo; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The cochineal Dactylopius coccus is an industrially-important insect used to extract carminic acid (a red dye). The effect of mating on the maturation of its ovaries was determined. In order to do this, three-month old mated and virgin females were used which were counted from Opuntia ficus indica cladode infestation (in Montecillo, Mexico). The morphophysiological characteristics of the degree of maturation of their ovarioles were evaluated. Mating was not needed to start the maturation of the ovarioles, because in virgin females, a low percentage of oocytes successfully complete vitellogenesis and choriogenesis; however, mating promotes both processes, since the proportion of mature oocytes produced in mated females noticeably increases. Similarly, lack of mating in D. coccus was a factor that induced degeneration of the ovarioles, and consequently, the resorption of their oocytes.
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    Evaluation of Beauveria bassiana for Monalonion velezangeli (Hemiptera: Miridae) control in coffee crop.
    (Universidad del Valle, 2020-07-09) Góngora, Carmenza E.; Laiton J., Laura A.; Gil, Zulma N.; Benavides, Pablo; Montoya Lerma, James
    Monalonion velezangeli (Hemiptera: Miridae) is a polyphagous pest found in Colombia which attacks ornamentals, weeds, timber and fruit trees including coffee. The pathogenicity of Beauveria bassiana strain B at 1 x 107 conidia/ml was evaluated on Monalonion velezangeli by immersion. The fungus caused 84 % mortality on the insect. Cissus verticillata plants were infested with M. velezangeli and applications of the fungus at 4 x 1010 conidium/L were done. Average insects mortality treated with the fungus was 84 %. Under field conditions, in the department of Huila, in a coffee plot infested with M. velezangeli the following treatment were applied: strain B at 4 x 1010 conidium/L, insecticide Chlorpyrifos at 4 cc/L and water. In a first assay, groups of nine trees (20 repetitions) were chosen. Both the insecticides and the fungus caused insect mortality with an 80 to 90 % decrease in the percentage of trees with new damage. Meanwhile the decrease in the control was 40 %. In a second assay, three plots of 450 trees were selected and the same treatments were applied. Percentage of trees affected in the control ranged between 19 and 11 %. The plot in which the insecticide was applied, started with an infestation of 29 %, and at the end of the assay the infestation was 20 % and the highest damage was observed in this plot. In the plot where B. bassiana was applied the initial infestation was 30 % and at the end of the assay, this plot showed the lowest infestation level near to 5 %. The B. bassiana strain B becomes a feasible alternative for M. velezangeli pest control on coffee plantations.
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    First report of Euschistus heros (Hemiptera: Pentatomidae) damaging teak trees (Tectona grandis) in the neotropics.
    (Universidad del Valle, 2020-12-26) Garcia Costa, Jerffersoney; Fialho Junior, Leonardo Leite; Lima Santos, Isabel Carolina de; Zanetti, Ronald; Santos, Alexandre Dos; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    Teak, Tectona grandis is one of the most valuable woods in the world. In Brazil, it is attacked by sap-sucking insects such as Euschistus heros, known as Neotropical brown stink bug. Here we report the first occurrence of this pest in teak tree plantations in Cáceres, Mato Grosso, Brazil. The injuries on the trees were characterized and photographed, along with the insects collected on plants. Injuries caused the apical bud to dry, advancing to the entire plant drying. Injuries occur from the histological damage caused by insect stylets and the toxic enzyme released into plant cells.
  • Cargando...
    Miniatura
    PublicaciónAcceso abierto
    Population fluctuation and parasitism of Aleurothrixus floccosus (Hemiptera: Aleyrodidae)in citrus trees from Atacama Desert, Chile.
    (Universidad del Valle, 2021-02-03) Tello Mercado, Víctor; Zarzar Maza, Miguel; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The effect of three different types of crop management on parasitism of Aleurothrixus floccosus in the Atacama Desert was studied. The studied parasitoids were: Cales noacki, Eretmocerus paulistus, Amitus spiniferus, and the hyperparasitoid Signiphora sp. The study was performed in Pica Oasis, located in the Atacama Desert, Tarapacá region, Chile, from February 2009 until February 2011. Three orchards were selected based on the type of plantation: the Bajo Miraflores Sector with plantation frames (5 x 5 m) and pruning management; the San Lorenzo Sector without plantation frames or pruning management; and Miraflores Sector that represents a mixed system between both of them. Two sampling procedures were applied. One was of the absolute type, in which 36 leaves per tree were collected from four labeled trees that were sampled twice a month, and the other was collected through yellow sticky chrome-attracting traps set in the central part of each of the labeled trees used for absolute sampling. The results indicate that in the Oasis of Pica, the different stages of A. floccosus are distributed throughout the year; with all stages represented during every month. The three sampled sectors exhibited different population levels of A. floccosus. The hyperparasitoid Signophora sp. presented the highest population density. The average parasitism percentage of A. floccosus in Pica was lower than 15 %.
Universidad del Valle
Universidad del Valle
  • Cali - Colombia
  • © 1994 - 2023
Dirección:
  • Ciudad Universitaria Meléndez
  • Calle 13 # 100-00
  •  
  • Sede San Fernando
  • Calle 4B N° 36-00
PBX:
  • +57 2 3212100
Línea gratuita PQRS
  • 018000 220021
  •  
Apartado Aéreo
  • 25360
Redes Sociales:
La Universidad
  • consejo-superior

    Consejo Superior
  • consejo-academico

    Consejo Académico
  • rectoria

    Rectoría
  • Nuestros Símbolos
  • acerca-de-univalle

    Acerca de Univalle
  • dependencias

    Dependencias
  • Museos

    Museos y Colecciones
  • Fotos de la Universidad
  • Mapa del Campus
  • tour-por-la-universidad

    Tour por la Universidad
  • daca

    Normatividad
  • horarios-de-atencion

    Horarios de atención
  • Portal de niños
  • Política de Tratamiento de
    la Información Personal
  • Accesibilidad digital
Estudia en Univalle
  • pregrado

    Pregrado
  • Postgrado
  • cursos-y-talleres

    Educación contínua
Sedes Regionales
  • Tuluá
  • Buga
  • univallecaicedonia

    Caicedonia
  • Cartago
  • Norte del Cauca
  • Pacífico
  • Palmira
  • Yumbo
  • zarzal

    Zarzal
  • Regionalización
Investigación
  • Acerca de la Vicerrectoría de investigaciones
  • Institutos, Centros y Grupos
  • Convocatorias
  • Universidad - Empresa (OTRI)
  • Dirección de Relaciones Internacionales
  • Programa Editorial
Internacionalización
  • Convocatorias

    Convocatorias
  • Estudia en Univalle

    Estudia en Univalle
  • Estudia

    Estudia en el exterior
  • Convenios

    Convenios Internacionales
  • Investiga

    Investiga en Univalle
  • Solicitudes

    Solicitudes / Trámites
  • About

    About Univalle
  • Contactos

    Contactos
Publicaciones
  • Libros
  • Periódico campus

2024 Universidad del Valle - Vigilada MinEducación

Sistema DSPACE 7 - Metabiblioteca | logo