Examinando por Materia "Palmas"

Mostrando 1 - 2 de 2
  • Miniatura
    PublicaciónAcceso abierto
    Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.
    (Universidad del Valle, 2020-12-26) Ramos Hernández, Eder; Lesher Gordillo, María Juliana; Ortiz García, Carlos Fredy; Oropeza Salín, Carlos; Sánchez Soto, Saúl; Magaña Alejandro, Miguel Ángel; Narváez C., María del S.; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.
  • Miniatura
    PublicaciónAcceso abierto
    Population variation of Rhodnius prolixus (Reduviidae: Triatominae) in Attalea butyracea (Arecaceae) in the Colombian Orinoquia región.
    (Universidad del Valle, 2018-12-31) Urbano, Plutarco; Hincapié, Eduwin; Angulo, Víctor Manuel; Esteban, Lyda; Núñez Avellaneda, Luís Alberto; Sociedad Colombiana de Entomología - Socolen; Universidad del Valle; Montoya Lerma, James
    The objective of this study was to determine the population density of Rhodnius prolixus and its developmental stages in natural forests of Attalea butyracea during a hydrological period in flooded savanna ecosystems of the Colombian Orinoquia region. One hundred twenty (120) palms were sampled over a period of one year using live bait traps for Triatomine bugs. Sampling showed that R. prolixus presents a high population density throughout the year, which increases during periods of low rainfall and decreases during the months of greatest precipitation. It was also found that all developmental stages of R. prolixus are presented throughout the year, although there are differences in their representation; showing decreases in density as developmental stages advance. Additionally, infestation, colonization and clustering were observed. The above suggests that the species presents population stability in A. butyracea forests without regard to climatic period, as well as reproductive success; thus individuals have the capacity to disperse and colonize other microhabitats at any time, regardless of climatic condition