Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.
| dc.contributor.author | Ramos Hernández, Eder | |
| dc.contributor.author | Lesher Gordillo, María Juliana | |
| dc.contributor.author | Ortiz García, Carlos Fredy | |
| dc.contributor.author | Oropeza Salín, Carlos | |
| dc.contributor.author | Sánchez Soto, Saúl | |
| dc.contributor.author | Magaña Alejandro, Miguel Ángel | |
| dc.contributor.author | Narváez C., María del S. | |
| dc.contributor.corporatename | Sociedad Colombiana de Entomología - Socolen | spa |
| dc.contributor.corporatename | Universidad del Valle | spa |
| dc.contributor.editor | Montoya Lerma, James | |
| dc.date.accessioned | 2021-07-22T16:50:06Z | |
| dc.date.available | 2021-07-22T16:50:06Z | |
| dc.date.issued | 2020-12-26 | |
| dc.description.abstract | The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms. | spa |
| dc.format.extent | 1 recurso en línea (7 páginas) | spa |
| dc.format.mimetype | application/pdf | spa |
| dc.identifier.uri | https://hdl.handle.net/10893/20824 | |
| dc.language.iso | eng | spa |
| dc.publisher | Universidad del Valle | spa |
| dc.publisher.place | Colombia | spa |
| dc.relation.citationendpage | 7 | spa |
| dc.relation.citationissue | 2 | spa |
| dc.relation.citationstartpage | 1 | spa |
| dc.relation.citationvolume | 46 | spa |
| dc.relation.ispartofjournal | Revista Colombiana de Entomología | spa |
| dc.rights.accessrights | info:eu-repo/semantics/openAccess | spa |
| dc.subject.ddc | Palmas | |
| dc.subject.ddc | PCR tiempo real | |
| dc.subject.ddc | Vector de fitoplasma | |
| dc.subject.ddc | Haplaxius crudus | |
| dc.subject.ddc | Haplaxius skarphion | |
| dc.subject.ddc | Oecleus snowi | |
| dc.subject.ddc | Persis foveatis | |
| dc.subject.ddc | Cixiidae | |
| dc.subject.ddc | Derbidae | |
| dc.subject.ddc | Hemiptera | |
| dc.title | Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV. | spa |
| dc.type | Artículo de revista | spa |
| dc.type.coar | http://purl.org/coar/resource_type/c_6501 | spa |
| dc.type.content | Text | spa |
| dc.type.driver | info:eu-repo/semantics/article | spa |
| dc.type.redcol | http://purl.org/redcol/resource_type/ART | spa |
| dc.type.version | info:eu-repo/semantics/publishedVersion | spa |
| dspace.entity.type | Publication | |
| oaire.accessrights | http://purl.org/coar/access_right/c_abf2 | spa |
| oaire.version | http://purl.org/coar/version/c_970fb48d4fbd8a85 | spa |
Archivos
Bloque original
1 - 1 de 1
Cargando...
- Nombre:
- Cixiidae and Derbidae.pdf
- Tamaño:
- 326.39 KB
- Formato:
- Adobe Portable Document Format
- Descripción:
Bloque de licencias
1 - 1 de 1
No hay miniatura disponible
- Nombre:
- license.txt
- Tamaño:
- 14.48 KB
- Formato:
- Item-specific license agreed upon to submission
- Descripción:
